Tilted Forum Project Discussion Community  

Go Back   Tilted Forum Project Discussion Community > The Academy > Tilted Knowledge and How-To


 
 
LinkBack Thread Tools
Old 09-22-2004, 03:39 PM   #1 (permalink)
#1 Irish Fan
 
heccubusiv's Avatar
 
Location: The Burgh
Genetics

If you have the mRNA strand:

AUGUUUGGGCCCAAAUAACCGG

How many amino acids does it produce.

AUG would produce Met
UUU would make Phe
GGG would make Gly
AAA would make Pro
UAA would be the stop codone

The problem is that AUG is the standard start codon, does it just count as the start codon or does it produce an amino acid also. Thanks for the help
__________________
Fuck Ohio
heccubusiv is offline  
Old 09-23-2004, 08:33 PM   #2 (permalink)
!?!No hay pantalones!?!
 
saltfish's Avatar
 
Location: Indian-no-place
UAG is the start codon for every translated polypeptide and it codes for the amino acid methionine.

I married a PhD Genetic Biologist.



-SF
saltfish is offline  
Old 09-26-2004, 01:59 PM   #3 (permalink)
Crazy
 
Location: Saratoga Springs, NY
saltfish is correct. The AUG is translated into met.

Don't know what this if for, but if it is for a class and the teacher is trying to make it a trick question, you also need to look at the other reading frames (granted there is no start codon in the other reading frames, but you didn't stipulate that this sequence wasn't taken from the middle of a gene):

1st Open reading frame (ORF): AUG UUU GGG CCC AAA UAA CCG

2nd ORF: UGU UUG GGC CCA AAU AAC CCG

3rd ORF: GUU UGG GCC CAA AUA ACC

BTW, many proteins (especially viral proteins where they have to pack as much as possible into a small genome) are translated from overlapping reading frames. So that in some cases, one strand of RNA can produce three separate proteins.

Last edited by hokieian; 09-26-2004 at 02:02 PM..
hokieian is offline  
Old 10-24-2004, 10:14 PM   #4 (permalink)
Upright
 
Location: Virginia, USA
Quote:
Originally Posted by hokieian
saltfish is correct. The AUG is translated into met.

Don't know what this if for, but if it is for a class and the teacher is trying to make it a trick question, you also need to look at the other reading frames (granted there is no start codon in the other reading frames, but you didn't stipulate that this sequence wasn't taken from the middle of a gene):

1st Open reading frame (ORF): AUG UUU GGG CCC AAA UAA CCG

2nd ORF: UGU UUG GGC CCA AAU AAC CCG

3rd ORF: GUU UGG GCC CAA AUA ACC

BTW, many proteins (especially viral proteins where they have to pack as much as possible into a small genome) are translated from overlapping reading frames. So that in some cases, one strand of RNA can produce three separate proteins.



A Student of Dr. Gregory?

Tech, Tech, VPI!
hokiesandwich is offline  
Old 10-25-2004, 06:30 AM   #5 (permalink)
Insane
 
Location: California
Quote:
Originally Posted by heccubusiv
If you have the mRNA strand:

AUGUUUGGGCCCAAAUAACCGG

How many amino acids does it produce.

AUG would produce Met
UUU would make Phe
GGG would make Gly
AAA would make Pro
UAA would be the stop codone

The problem is that AUG is the standard start codon, does it just count as the start codon or does it produce an amino acid also. Thanks for the help
5 amino acids would be produced, Methionine-Phenylalanine-Glycine-Proline-Arginine. The stop codon would then end the chain, and no further codons would be translated (so you wouldn't stop this chain, and then pick up the next codon, which is a proline. You would just stop.)

Also, AAA is Lysine, not Proline. Proline is CCC, CCU, CCA, and CCG.

AUG as the start codon does indeed attach Methionine to the beginning of the amino acid chain. In several species, E. Coli is one I believe, it will be N-formylated for f(ormyl)-Methioinine (fMet) but that probably wouldn't be necessary to include unless the conditions of the problem were specific enough to tell you that it would be that way.
__________________
It's not getting what you want, it's wanting what you've got.
mo42 is offline  
 

Tags
genetics


Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On



All times are GMT -8. The time now is 06:41 PM.

Tilted Forum Project

Powered by vBulletin® Version 3.8.7
Copyright ©2000 - 2026, vBulletin Solutions, Inc.
Search Engine Optimization by vBSEO 3.6.0 PL2
© 2002-2012 Tilted Forum Project

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360