Thread: Genetics
View Single Post
Old 10-25-2004, 06:30 AM   #5 (permalink)
mo42
Insane
 
Location: California
Quote:
Originally Posted by heccubusiv
If you have the mRNA strand:

AUGUUUGGGCCCAAAUAACCGG

How many amino acids does it produce.

AUG would produce Met
UUU would make Phe
GGG would make Gly
AAA would make Pro
UAA would be the stop codone

The problem is that AUG is the standard start codon, does it just count as the start codon or does it produce an amino acid also. Thanks for the help
5 amino acids would be produced, Methionine-Phenylalanine-Glycine-Proline-Arginine. The stop codon would then end the chain, and no further codons would be translated (so you wouldn't stop this chain, and then pick up the next codon, which is a proline. You would just stop.)

Also, AAA is Lysine, not Proline. Proline is CCC, CCU, CCA, and CCG.

AUG as the start codon does indeed attach Methionine to the beginning of the amino acid chain. In several species, E. Coli is one I believe, it will be N-formylated for f(ormyl)-Methioinine (fMet) but that probably wouldn't be necessary to include unless the conditions of the problem were specific enough to tell you that it would be that way.
__________________
It's not getting what you want, it's wanting what you've got.
mo42 is offline  
 

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47