|
Genetics
If you have the mRNA strand:
AUGUUUGGGCCCAAAUAACCGG
How many amino acids does it produce.
AUG would produce Met
UUU would make Phe
GGG would make Gly
AAA would make Pro
UAA would be the stop codone
The problem is that AUG is the standard start codon, does it just count as the start codon or does it produce an amino acid also. Thanks for the help
__________________
Fuck Ohio
|