![]() |
Genetics
If you have the mRNA strand:
AUGUUUGGGCCCAAAUAACCGG How many amino acids does it produce. AUG would produce Met UUU would make Phe GGG would make Gly AAA would make Pro UAA would be the stop codone The problem is that AUG is the standard start codon, does it just count as the start codon or does it produce an amino acid also. Thanks for the help |
UAG is the start codon for every translated polypeptide and it codes for the amino acid methionine.
I married a PhD Genetic Biologist. ;) -SF |
saltfish is correct. The AUG is translated into met.
Don't know what this if for, but if it is for a class and the teacher is trying to make it a trick question, you also need to look at the other reading frames (granted there is no start codon in the other reading frames, but you didn't stipulate that this sequence wasn't taken from the middle of a gene): 1st Open reading frame (ORF): AUG UUU GGG CCC AAA UAA CCG 2nd ORF: UGU UUG GGC CCA AAU AAC CCG 3rd ORF: GUU UGG GCC CAA AUA ACC BTW, many proteins (especially viral proteins where they have to pack as much as possible into a small genome) are translated from overlapping reading frames. So that in some cases, one strand of RNA can produce three separate proteins. |
Quote:
A Student of Dr. Gregory? Tech, Tech, VPI! |
Quote:
Also, AAA is Lysine, not Proline. Proline is CCC, CCU, CCA, and CCG. AUG as the start codon does indeed attach Methionine to the beginning of the amino acid chain. In several species, E. Coli is one I believe, it will be N-formylated for f(ormyl)-Methioinine (fMet) but that probably wouldn't be necessary to include unless the conditions of the problem were specific enough to tell you that it would be that way. |
| All times are GMT -8. The time now is 10:05 AM. |
Powered by vBulletin® Version 3.8.7
Copyright ©2000 - 2026, vBulletin Solutions, Inc.
Search Engine Optimization by vBSEO 3.6.0 PL2
© 2002-2012 Tilted Forum Project